FVB-Ogtem1Mbou/Cnrm
| Status | Under development - register interest |
| EMMA ID | EM:15901 |
| Citation information | RRID:IMSR_EM:15901 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | FVB-Ogtem1Mbou/Cnrm |
| Alternative name | OgtY851A |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Ogtem1Mbou |
| Gene/Transgene symbol | Ogt |
Information from provider
| Provider | Matthieu Boulard |
| Provider affiliation | EMBL Rome , European Molecular Biology Laboratory |
| Genetic information | Substitution in exon 19 (Ogt-201): GTACTGTAACTTTAATCAGTTATATAAAATTGACCCATCT -> CTATTGCAATTTCAACCAACTGGCCAAGATCGATCCTAGC, ChrX:100719847->100719886 forward strand The mutant allele produces OGT with Y851 substituted in A. |
| Phenotypic information | Homozygous:Homozygous females and hemizygous males do not display adverse phenotypes. They are fertile. Sub-lethality was observed at weaning.Heterozygous:Heterozygous females and hemizygous males do not display adverse phenotypes. They are fertile. |
| Breeding history | The strain was maintained by crosses of heterozygous or hemizygous with FVB animals. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | CNR, Consiglio Nazionale delle Ricerche, Monterotondo, Italy |
Literature references
- Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryo.;Formichetti Sara, Sadowska Agnieszka, Ascolani Michela, Hansen Julia, Ganter Kerstin, Lancrin Christophe, Humphreys Neil, Boulard Mathieu, ;2025;PLoS genetics;21;e1011507; 39787076