Sprague Dawley rat Clcn4em3Ics
| Status | Available to order |
| EMMA ID | EM:15894 |
| Citation information | RRID:IMSR_EM:15894 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | Sprague Dawley rat Clcn4em3Ics |
| Alternative name | rat Clcn4em3Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | rat Clcn4 |
| Gene/Transgene symbol | rat Clcn4 |
Information from provider
| Provider | Cure CLCN4 |
| Provider affiliation | Cure CLCN4 |
| Genetic information | The Clcn4 cKO rat model was generated using a CRISPR mediated sequencial inserting of 2 LoxP sites 5' and 3' of exon 4 (ENSRNOE00000033426.1), a critical exon. The 5' LoxP site was first inserted by electroporation of a ssODN and guide RNAs (TGCTGCATGAATAACGTGAC and GCTGCATGAATAACGTGACT, 5' guide RNA pair). Heterogous animals were obtained then a new electroporation was performed on heterozygous eggs with a ssODN carrying the 3' LoxP and guide RNAs TCATAAACCTATGCAGCGTG and CTGTCATCCACACGCTGCAT, 3' guide RNAs pair). The insertion of both LoxP was confirmed. The sequence of the conditional allele as well of the genotyping protocol are provided in this. For additional information, please have a look at this report. |
| Phenotypic information | Homozygous:No phenotype observedHeterozygous:No phenotype observed |
| Breeding history | The line was kept in a Sprague Dawley (Janvier Labs; RjHan:SD strain) genetic background. |
| References | None available |
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |