IMPC phenotypes (gene matching)
C57BL/6N-Prune1em1(IMPC)Ics/Ics
| Status | Available to order |
| EMMA ID | EM:15795 |
| International strain name | C57BL/6N-Prune1em1(IMPC)Ics/Ics |
| Alternative name | Prune1em1(IMPC)ICS |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Prune1em1(IMPC)Ics |
| Gene/Transgene symbol | Prune1 |
Information from provider
| Provider | ICS, Institut Clinique de la Souris |
| Provider affiliation | ICS, Institut Clinique de la Souris |
| Genetic information | This allele was generated at the Institute Clinique de la Souris by microinjecting a mix of Cas9 RNA, an RNA guide (CTTACTTGGGTAAAATATGG) and a single stranded donor DNA, which resulted in the p.D106N mutation of Prune1 in exon 3 (ENSMUSE00000253496; GRCm39). A DdeI diagnostic restriction site is associated to the mutation to facilitate genotyping. This line is cryopreserved. "Note: The mouse strains EM:13030 and EM:15795 carry the same point mutation, D106N. They were created independently by the Mary Lyon Centre at MRC Harwell and Institut Clinique de la Souris respectively. The two strains differ in their backgrounds. EM:13030 carries the allele on a C57BL/6NTac background whereas EM:15795 carries the allele on a C57BL/6NCRL background." |
| Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
| Breeding history | This line was generated on a pure C57BL/6N genetic background. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | not known |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- PRUNE1-related neurological syndrome / Orphanet_544469