- hyperactivity / IMPC
- abnormal auditory brainstem response / IMPC
- increased aggression / IMPC
- abnormal vocalization / IMPC
- decreased bone mineral density / IMPC
- decreased erythrocyte cell number / IMPC
- abnormal contextual conditioning behavior / IMPC
- increased circulating creatinine level / IMPC
- increased exploration in new environment / IMPC
- increased lean body mass / IMPC
- abnormal spleen morphology / IMPC
- increased vertical activity / IMPC
- abnormal locomotor behavior / IMPC
- abnormal cued conditioning behavior / IMPC
C57BL/6N-Ptchd1em1(IMPC)Ics/Ics
Status | Available to order |
EMMA ID | EM:15794 |
International strain name | C57BL/6N-Ptchd1em1(IMPC)Ics/Ics |
Alternative name | Ptchd1em1(IMPC)Ics |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Ptchd1em1(IMPC)Ics |
Gene/Transgene symbol | Ptchd1 |
Information from provider
Provider | ICS, Institut Clinique de la Souris |
Provider affiliation | ICS, Institut Clinique de la Souris |
Genetic information | This allele was generated at the Institute Clinique de la Souris by electroporating Cas9 protein, a crRNA (GTTGATTGATTGCAGATAGT)/tracRNA and a single stranded donor DNA, which resulted in the p.Y213C mutation of Ptchd1 exon 2 (ENSMUSE00000252591; GRCm39). A NspI diagnostic restriction site is associated to the mutation to facilitate genotyping. This line is cryopreserved. |
Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
Breeding history | This line was generated on a pure C57BL/6N genetic background. |
References | None available |
Homozygous fertile | not known |
Homozygous viable | not known |
Homozygous matings required | not known |
Immunocompromised | not known |
Information from EMMA
Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
IMPC phenotypes (gene matching)
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).