C57BL/6N-Ptchd1em1(IMPC)Ics/Ics

Status

Available to order

EMMA IDEM:15794
Citation informationRRID:IMSR_EM:15794 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

 
International strain nameC57BL/6N-Ptchd1em1(IMPC)Ics/Ics
Alternative namePtchd1em1(IMPC)Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolPtchd1em1(IMPC)Ics
Gene/Transgene symbolPtchd1

Information from provider

Provider ICS, Institut Clinique de la Souris
Provider affiliationICS, Institut Clinique de la Souris
Genetic informationThis allele was generated at the Institute Clinique de la Souris by electroporating Cas9 protein, a crRNA (GTTGATTGATTGCAGATAGT)/tracRNA and a single stranded donor DNA, which resulted in the p.Y213C mutation of Ptchd1 exon 2 (ENSMUSE00000252591; GRCm39). A NspI diagnostic restriction site is associated to the mutation to facilitate genotyping. This line is cryopreserved.
Phenotypic informationHomozygous:
NA

Heterozygous:
Viable, no obvious phenotype
Breeding historyThis line was generated on a pure C57BL/6N genetic background.
ReferencesNone available
Homozygous fertilenot known
Homozygous viablenot known
Homozygous matings requirednot known
Immunocompromisednot known

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

IMPC phenotypes (gene matching)
  • hyperactivity / IMPC
  • abnormal auditory brainstem response / IMPC
  • increased aggression / IMPC
  • abnormal vocalization / IMPC
  • decreased bone mineral density / IMPC
  • decreased erythrocyte cell number / IMPC
  • abnormal contextual conditioning behavior / IMPC
  • increased circulating creatinine level / IMPC
  • increased exploration in new environment / IMPC
  • increased lean body mass / IMPC
  • abnormal spleen morphology / IMPC
  • increased vertical activity / IMPC
  • abnormal locomotor behavior / IMPC
  • abnormal cued conditioning behavior / IMPC

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Other EMMA strains

Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).