C57BL/6N-Dyrk1aem1(IMPC)Ics/Ics
| Status | Available to order |
| EMMA ID | EM:15793 |
| International strain name | C57BL/6N-Dyrk1aem1(IMPC)Ics/Ics |
| Alternative name | Dyrk1em1(IMPC)Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Dyrk1em1(IMPC)Ics |
| Gene/Transgene symbol | Dyrk1a |
Information from provider
| Provider | ICS, Institut Clinique de la Souris |
| Provider affiliation | ICS, Institut Clinique de la Souris |
| Genetic information | This allele was generated at the Institute Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CAAGCAGCCGCACTTCTATC) /tracRNA and a single stranded donor DNA, which resulted in the p.A195T mutation in exon 6 of Dyrk1a gene (ENSMUSE00000131727; GRCm39). A XmnI diagnostic restriction site was associated with the mutation to facilitate genotyping. This line is cryopreserved |
| Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
| Breeding history | This line was generated on a pure C57BL/6N genetic background. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | not known |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |