C57BL/6N-Btg3em1(IMPC)Ics/Ics
| Status | Available to order |
| EMMA ID | EM:15792 |
| International strain name | C57BL/6N-Btg3em1(IMPC)Ics/Ics |
| Alternative name | Btg3em1(IMPC)Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Btg3em1(IMPC)Ics |
| Gene/Transgene symbol | Btg3 |
Information from provider
| Provider | ICS, Institut Clinique de la Souris |
| Provider affiliation | ICS, Institut Clinique de la Souris |
| Genetic information | This allele was generated at the Institute Clinique de la Souris by electroporating Cas9 protein and 4 RNA guides (sequences: CTCTCATAAATGAGGAGACC, ATGAGCCCAGAGGAATCACC, TGGCTGGAGAAGCTGGCCGA and CAGGAGGGCAGCGCTTCCTT), which resulted in a 4891 bp deletion on Chromosome 16. This mutation deletes exons 3 and 4 of Btg3 gene (ENSMUSE00000482894 and ENSMUSE00000476530; GRCm39), leading to a frameshift and premature stop. This line is cryopreserved. |
| Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
| Breeding history | This line was generated on a pure C57BL/6N genetic background. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | not known |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |