C57BL/6N-Mcm3apem1(IMPC)Ics/Ics
Status | Available to order |
EMMA ID | EM:15791 |
Citation information | RRID:IMSR_EM:15791 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
International strain name | C57BL/6N-Mcm3apem1(IMPC)Ics/Ics |
Alternative name | Mcm3apem1(IMPC)Ics |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Mcm3apem1(IMPC)Ics |
Gene/Transgene symbol | Mcm3ap |
Information from provider
Provider | ICS, Institut Clinique de la Souris |
Provider affiliation | ICS, Institut Clinique de la Souris |
Genetic information | This allele was generated at the Institute Clinique de la Souris by electroporating Cas9 protein and 4 RNA guides (sequences: CTTAAAATCAAGTGACCACA, GATTTTAAGTCCCACGATCT, TCCTAGCATACCTACGGGGT and CACATCCTAGCATACCTACG), which resulted in a 2796 bp deletion on chromosome 10. This mutation deletes exon 3 (ENSMUSE00000102257; GRCm39), leading to a frameshift with a premature stop. This line is cryopreserved |
Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
Breeding history | This line was generated on a pure C57BL/6N genetic background. |
References | None available |
Homozygous fertile | not known |
Homozygous viable | not known |
Homozygous matings required | not known |
Immunocompromised | not known |
Information from EMMA
Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).