- abnormal hair follicle orientation / MGI
- increased curvature of guard hairs / MGI
- increased curvature of awl hairs / MGI
- increased curvature of zigzag hairs / MGI
- increased curvature of auchene hairs / MGI
- waved hair / MGI
- curly vibrissae / MGI
- decreased embryo size / MGI
- absent vitelline blood vessels / MGI
- abnormal extraembryonic tissue morphology / MGI
- no abnormal phenotype detected / MGI
- no phenotypic analysis / MGI
- decreased tumor growth/size / MGI
- abnormal trophoblast layer morphology / MGI
- abnormal ectoplacental cone morphology / MGI
- abnormal trophoblast giant cell morphology / MGI
- embryonic lethality between somite formation and embryo turning, complete penetrance / MGI
- embryonic lethality during organogenesis, complete penetrance / MGI
C57BL/6N-Ets2em1(IMPC)Ics/Ics
Status | Available to order |
EMMA ID | EM:15788 |
International strain name | C57BL/6N-Ets2em1(IMPC)Ics/Ics |
Alternative name | Ets2em1(IMPC)Ics |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Ets2em1(IMPC)Ics |
Gene/Transgene symbol | Ets2 |
Information from provider
Provider | ICS, Institut Clinique de la Souris |
Provider affiliation | ICS, Institut Clinique de la Souris |
Genetic information | This allele was generated at the Institute Clinique de la Souris by electroporating Cas9 protein and 4 RNA guides (sequences: TTGACGGCGTGCTTTCTTAG, GGACCCATGGCAGGGTTACT, GGTCATTCTGGTGTCGTCAC and ACAGACAGTTCTCGGCTCAC), which resulted in the deletion of Ets2 exon 3 (ENSMUSE00001449193; GRCm39). This mutation deletes exon 3 (ENSMUSE00001449193; GRCm39), leading to a frameshift with a premature stop. This line is cryopreserved. |
Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
Breeding history | This line was generated on a pure C57BL/6N genetic background. |
References | None available |
Homozygous fertile | not known |
Homozygous viable | not known |
Homozygous matings required | not known |
Immunocompromised | not known |
Information from EMMA
Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
MGI phenotypes (gene matching)
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).