- abnormal motor coordination/balance / MGI
C57BL/6N-Kcnj15em1(IMPC)Ics/Ics
Status | Available to order |
EMMA ID | EM:15785 |
International strain name | C57BL/6N-Kcnj15em1(IMPC)Ics/Ics |
Alternative name | Kcnj15em1(IMPC)Ics |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Kcnj15em1(IMPC)Ics |
Gene/Transgene symbol | Kcnj15 |
Information from provider
Provider | ICS, Institut Clinique de la Souris |
Provider affiliation | ICS, Institut Clinique de la Souris |
Genetic information | This allele was generated at the Institute Clinique de la Souris by electroporating Cas9 protein and 4 RNA guides (sequences: ATATAGTTATTGCATGCGGT, TATATTTAGTCTTATGGCAC, CCACGAACGTCTGTGTGATT and CGTCTGTGTGATTTGGTAGT), which resulted in a 1325 bp deletion on Chromosome 16. Kcnj15 exon 4 is partially deleted (ENSMUSE00001264674; GRCm39), leading to a frameshift with a premature stop. This line is cryopreserved. |
Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
Breeding history | This line was generated on a pure C57BL/6N genetic background. |
References | None available |
Homozygous fertile | not known |
Homozygous viable | not known |
Homozygous matings required | not known |
Immunocompromised | not known |
Information from EMMA
Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
MGI phenotypes (gene matching)
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).