rat SD-Mifem1Ics/Ics

Status

Available to order

EMMA IDEM:15567
Citation informationEM:15567 
International strain namerat SD-Mifem1Ics/Ics
Alternative nameSprague Dawley rat Mif em1Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolrat Mifem1Ics
Gene/Transgene symbolrat Mif

Information from provider

ProviderMarie-Christine Birling
Provider affiliationGenetic Engineering , PHENOMIN-ICS
Genetic informationThis Mif knock-out rat line was obtained by microinjection of Cas9 mRNA and 2 pairs of guide RNAs - actacctagcttattaaatg (gR76), gcatcctccgtttctatctt (gR79), tccaggctgggaacgtgcga (gR94) and cccatcgcacgttcccagcc (gR94) - in Sprague-Dawley embryos. It resulted in the deletion of whole gene sequence (spanning over 1027 bps) of rat Mif. This deletion leads to the knock-out of Mif.
Phenotypic informationHomozygous:
Homozygous animal are viable.

Heterozygous:
No phenotype observed.
Breeding historyThe line was kept in a Sprague-Dawley background.
ReferencesNone available
Homozygous fertilenot known
Homozygous viableyes
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen embryos. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).