Sprague Dawley rat Mifem1Ics
| Status | Available to order |
| EMMA ID | EM:15567 |
| International strain name | Sprague Dawley rat Mifem1Ics |
| Alternative name | Sprague Dawley rat Mif |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | endonuclease-mediated mutation 1, Mouse Clinical Institute |
| Gene/Transgene symbol | Mif |
Information from provider
| Provider | Marie-Christine Birling |
| Provider affiliation | Genetic Engineering , PHENOMIN-ICS |
| Genetic information | This Mif knock-out rat line was obtained by microinjection of Cas9 mRNA and 2 pairs of guide RNAs - actacctagcttattaaatg (gR76), gcatcctccgtttctatctt (gR79), tccaggctgggaacgtgcga (gR94) and cccatcgcacgttcccagcc (gR94) - in Sprague Dawley embryos. It resulted in the deletion of whole gene sequence (spanning over 1027 bps) of rat Mif. This deletion leads to the knock-out of Mif. |
| Phenotypic information | Homozygous:homozygous animal are viableHeterozygous:no phenotype observed |
| Breeding history | The line was kept in a Sprague Dawley background. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |