- increased blood urea nitrogen level / IMPC
- decreased eosinophil cell number / IMPC
- decreased circulating iron level / IMPC
- decreased fasting circulating glucose level / IMPC
- preweaning lethality, complete penetrance / IMPC
- increased circulating amylase level / IMPC
- decreased circulating serum albumin level / IMPC
- impaired righting response / IMPC
- increased circulating triglyceride level / IMPC
- decreased respiratory quotient / IMPC
- hyperactivity / IMPC
- decreased red blood cell distribution width / IMPC
- increased circulating creatinine level / IMPC
- abnormal bone structure / IMPC
- decreased erythrocyte cell number / IMPC
- increased mean corpuscular hemoglobin / IMPC
- decreased bone mineral content / IMPC
- decreased anxiety-related response / IMPC
C57BL/6J-Gnao1em2Katv/Cnrm
Status | Under development - register interest |
EMMA ID | EM:14988 |
International strain name | C57BL/6J-Gnao1em2Katv/Cnrm |
Alternative name | B6.Gnao1 C215Y/Ugfm |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Gnao1em2Katv |
Gene/Transgene symbol | Gnao1 |
Information from provider
Provider | Fabrizio Thorel |
Provider affiliation | Transgenesis facility, University of Geneva |
Genetic information | Mutation: Gnao1 c.644G>A CRISPR/Cas9 gRNA: CCGTGACATCCTCAAAGCAG ssDNA:GGCCAGCGATCTGAACGCAAGAAGTGGATCCACTACTTTGAGGA TGTCACGGCCATCATCTTCTGTGTCGCACTCAGCGGCTATGACCAGG CRISPR technology details: Recombinant HiFi Cas9 Nuclease (cat. # 1081060 from IDT) mixed with nucleotides was directly injected in the embryos. |
Phenotypic information | Homozygous:The animals were found to exert no epilepsy-like behavior (no spontaneous seizures, visible movement difficulties were observed) or other abnormalities in normal housing conditions in either homozygous or heterozygous state. In certain behavioral experiments demonstrate weak-to-mild phenotypes of hyperkinesia. All the details can be found in the associated publication (DOI: 10.1186/s40478-022-01312-z)Heterozygous:Certain mild differences were identified between homo- and heterozygous animals indicating certain aggravation of the phenotype in homozygous state. However, in the normal housing conditions homozygous animals are largely normal and good breeders. |
Breeding history | Generation of the mutant was performed on pure C57BL/6 background. F0 generation consisted of 1 heterozygous (male) and 5 homozygous (4 males, 1 female) animals. One homozygous male was chosen based on the best breeding performance and his sperm was the one deposited. At the time of the deposit we had produced F4 generation including both hetero- and homozygous animals. |
References |
|
Homozygous fertile | yes |
Homozygous viable | yes |
Homozygous matings required | no |
Immunocompromised | no |
Information from EMMA
Archiving centre | CNR, Consiglio Nazionale delle Ricerche, Monterotondo, Italy |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Early infantile epileptic encephalopathy / Orphanet_1934
- GNAO1-related developmental delay-seizures-movement disorder spectrum / Orphanet_592564
IMPC phenotypes (gene matching)
MGI phenotypes (gene matching)
- tremors / MGI
- sporadic seizures / MGI
- decreased body weight / MGI
- decreased body size / MGI
- abnormal social investigation / MGI
- abnormal locomotor behavior / MGI
- unidirectional circling / MGI
- hyperactivity / MGI
- impaired coordination / MGI
- abnormal kindling response / MGI
- abnormal reproductive system physiology / MGI
- infertility / MGI
- increased circulating insulin level / MGI
- premature death / MGI
- increased insulin secretion / MGI
- abnormal channel response / MGI
- abnormal nervous system physiology / MGI
- abnormal hormone level / MGI
- abnormal body size / MGI
- decreased thermal nociceptive threshold / MGI
- abnormal cone electrophysiology / MGI
- abnormal myocardial fiber physiology / MGI
- abnormal behavior / MGI
- improved glucose tolerance / MGI
- homeostasis/metabolism phenotype / MGI
- behavior/neurological phenotype / MGI
- vision/eye phenotype / MGI
- hyperalgesia / MGI
- abnormal eye electrophysiology / MGI
- decreased circulating glucose level / MGI
- abnormal spike wave discharge / MGI
- mortality/aging / MGI
- abnormal survival / MGI
- lethality, incomplete penetrance / MGI
- postnatal lethality, incomplete penetrance / MGI
- neonatal lethality, incomplete penetrance / MGI
- preweaning lethality, incomplete penetrance / MGI
- lethality, complete penetrance / MGI
Literature references
- Mouse models characterize GNAO1 encephalopathy as a neurodevelopmental disorder leading to motor anomalies: from a severe G203R to a milder C215Y mutation.;Silachev Denis, Koval Alexey, Savitsky Mikhail, Padmasola Guru, Quairiaux Charles, Thorel Fabrizio, Katanaev Vladimir L, ;2022;Acta neuropathologica communications;10;9; 35090564
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).