| Status | Available to order |
| EMMA ID | EM:13607 |
| International strain name | B6N;FVB-Wdr45em1Wrst/Ieg |
| Alternative name | Wdr45 -/-; Wdr45 -/Y; Wdr45 -/+ |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Wdr45em1Wrst |
| Gene/Transgene symbol | Wdr45 |
| Provider | Holger Prokisch |
| Provider affiliation | HMGU |
| Additional owner | Dr. Ancangela Iuso, HMGU, Munich, Germany.
Generation of this BPAN mouse model was funded by the patient organisation 'NBIA Disorders Association', which would be interested in collaboration/exchange with any scientist obtaining this strain from EMMA. They can be contacted at info@NBIAdisorders.org. |
| Genetic information | We have introduced a 20-bp deletion in exon 2 of the gene Wdr45 using the TALENs technique. This deletion causes a frameshift and is predicted to introduce a premature stop codon 35 amino acids after the initial methionine. |
| Phenotypic information | Homozygous:Homozygous: Increased slips and falls, increased traversing times, increased tremor and limb grasping, no ABR response, reduced response to click, retinal degeneration, reduced retinal and cornea thickness, increment of the axial length, deeper anterior chamber, increased plasma creatinine, glucose, ASAT, LDH, ALP, and decreased plasma lactate, slightly increased plasma iron concentration and increased transferrin saturation, elevated RDW.Heterozygous:Hemizygous: Increased slips and falls, increased traversing times, increased locomotor activity and speed, impaired social recognition memory,increased tremor and limb grasping, no ABR response, reduced response to click,retinal degeneration, reduced retinal and cornea thickness, increment of the axial length, deeper anterior chamber,increment of the axial length, deeper anterior chamber, increased plasma creatinine, glucose, ASAT, LDH, ALP, and decreased plasma lactate, slightly increased plasma iron concentration and increased transferrin saturation, elevated RDW, decreased TP, albumin, TIBC in all KO and decreased alpha-amylase activity and triglycerides levels,slightly increased plasma iron concentration and increased transferrin saturation, elevated RDW, elevated WBC, RBC, HGB HCT. Spheroids and swollen structures (degenerated neurons) in basal ganglia, thalamus, cerebral cortex, medulla oblongata, ascending and descending fibres of the spinal cord and deep cerebellar nuclei. Progressive eosinophilic spheroids between 4-18 months. Ubiquitin: accumulation of aggregates in the medulla oblongata. GFAP: accumulation of aggregates in the medulla oblongata. CALB: impaired Purkinje cell layer of the cerebellar cortex. Dopamine: reduced number of neuroaxonal fibres in the substantia nigra. |
| Breeding history | Wdr45 knock-out mice were generated using the Transcription Activator-Like Effector Nucleases (TALEN) approach according to the established protocols (Boch et al. 2009; Zhang et al. 2011). The system was designed to introduce mutations in exon 2 of Wdr45 (NM_001290792.1, GRCm38.p6). Oligonucleotides were codon-optimized for murine usage (GenScript, New Jersey, USA). Before microinjection, TALEN efficiency was tested in vitro using reporter assays (Gal reporter gene assay, Roche Applied Science, Germany; High-sensitivity luciferase reporter gene assay, Roche Applied Science, Germany). Females of the inbred strain FVB were mated with C57BL/6N males. The resulting fertilized oocytes were collected, and TALENs were injected into the larger male pronucleus. Injected embryos were implanted into pseudopregnant CD-1 foster mothers, giving birth to animals with FVB and C57BL/6N mixed background. Sanger sequencing using the following primers Forward: CTTCAGAGAGGACACTGGGG and Reverse: TCAGGGTATACGTGGGAAGG identified a 20-bp deletion in mutant animals. The deletion is predicted to cause termination of the protein after 35 amino acids from the initial methionine. Animals from F0, mosaic for the 20-bp deletion in Wdr45, were bred to F1 generation to obtain uniform germline transmission of the mutation. Inbreeding of heterozygous females (Wdr45-/+) with a hemizygous male (Wdr45-/Y) from the F1 generation resulted in hemizygous (Wdr45-/Y, Wdr45+/Y), heterozygous (Wdr45-/+), and homozygous (Wdr45-/-) Wdr45 knock-out mice in the F2. By inbreeding F2 animals, we generated two larger Wdr45 knock-out cohorts used for in-depth analysis and progression analysis, respectively. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
| Archiving centre | Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH), Oberschleißheim, Germany |
Orphanet associated rare diseases, based on orthologous gene matching
