C57BL/6N-Mir182tm1Wtsi/WtsiH
| Status | Available to order |
| EMMA ID | EM:12223 |
| International strain name | C57BL/6N-Mir182tm1Wtsi/WtsiH |
| Alternative name | miR-182 |
| Strain type | Targeted Mutant Strains : Knock-out |
| Allele/Transgene symbol | Mir182tm1Wtsi |
| Gene/Transgene symbol | Mir182 |
Information from provider
| Provider | Haydn Prosser |
| Provider affiliation | Wellcome Trust Sanger Institute |
| Genetic information | miR-182 deletion: 6:30165901-30166091 (NCBIm38). Deleted genomic sequence for miR-182: tggaccttgtgttaactgtgggaagagcgccctcctaaaaccaccctaactgcttcttcttcagc ataggcttactggtctggctgctggaggcctcccaccatttttggcaatggtagaactcacacc ggtaaggtaatgggacccggtggttctagacttgccaactatggtgtaagtgctgagctgct |
| Phenotypic information | Homozygous:Mild hearing deficit.Heterozygous:No obvious phenotype. |
| Breeding history | Chimaeras derived from JM8.A3 ES cells (C57BL/6N) were bred with C57BL/6N mice. The mice will be supplied from the Sanger Institute as frozen sperm. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom |
Literature references
- Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects.;Lewis Morag A, Di Domenico Francesca, Ingham Neil J, Prosser Haydn M, Steel Karen P, ;2020;Disease models & mechanisms;14;; 33318051