C57BL/6N-Mir182tm1Wtsi/WtsiH
| Status | Available to order |
| EMMA ID | EM:12223 |
| Citation information | RRID:IMSR_EM:12223 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6N-Mir182tm1Wtsi/WtsiH |
| Alternative name | miR-182 |
| Strain type | Targeted Mutant Strains : Knock-out |
| Allele/Transgene symbol | Mir182tm1Wtsi |
| Gene/Transgene symbol | Mir182 |
Information from provider
| Provider | Haydn Prosser |
| Provider affiliation | Wellcome Trust Sanger Institute |
| Genetic information | miR-182 deletion: 6:30165901-30166091 (NCBIm38). Deleted genomic sequence for miR-182: tggaccttgtgttaactgtgggaagagcgccctcctaaaaccaccctaactgcttcttcttcagc ataggcttactggtctggctgctggaggcctcccaccatttttggcaatggtagaactcacacc ggtaaggtaatgggacccggtggttctagacttgccaactatggtgtaagtgctgagctgct |
| Phenotypic information | Homozygous:Mild hearing deficit.Heterozygous:No obvious phenotype. |
| Breeding history | Chimaeras derived from JM8.A3 ES cells (C57BL/6N) were bred with C57BL/6N mice. The mice will be supplied from the Sanger Institute as frozen sperm. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom |
Literature references
- Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects.;Lewis Morag A, Di Domenico Francesca, Ingham Neil J, Prosser Haydn M, Steel Karen P, ;2020;Disease models & mechanisms;14;; 33318051