C57BL/6N-Mir182tm1Wtsi/WtsiH

Status

Available to order

EMMA IDEM:12223
International strain nameC57BL/6N-Mir182tm1Wtsi/WtsiH
Alternative namemiR-182/Wtsi
Strain typeTargeted Mutant Strains : Knock-out
Allele/Transgene symbolMir182tm1Wtsi,
Gene/Transgene symbolMir182

Information from provider

ProviderHaydn Prosser
Provider affiliationWellcome Trust Sanger Institute
Genetic informationmiR-182 deletion: 6:30165901-30166091 (NCBIm38). Deleted genomic sequence for miR-182: tggaccttgtgttaactgtgggaagagcgccctcctaaaaccaccctaactgcttcttcttcagc ataggcttactggtctggctgctggaggcctcccaccatttttggcaatggtagaactcacacc ggtaaggtaatgggacccggtggttctagacttgccaactatggtgtaagtgctgagctgct
Phenotypic informationHomozygous:
Mild hearing deficit.

Heterozygous:
No obvious phenotype.
Breeding historyChimaeras derived from JM8.A3 ES cells (C57BL/6N) were bred with C57BL/6N mice. The mice will be supplied from the Sanger Institute as frozen sperm.
References
  • Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects.;Lewis Morag A, Di Domenico Francesca, Ingham Neil J, Prosser Haydn M, Steel Karen P, ;2020;Disease models & mechanisms;14;; 33318051
Homozygous fertileyes
Homozygous viableyes
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreMary Lyon Centre at MRC Harwell, Oxford, United Kingdom

Literature references

  • Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects.;Lewis Morag A, Di Domenico Francesca, Ingham Neil J, Prosser Haydn M, Steel Karen P, ;2020;Disease models & mechanisms;14;; 33318051

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*
  • Tissue - Types of tissue, service fee and delivery time available upon request

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable).

More details on pricing and delivery times

Practical information

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
MTA will be issued after an order has been submitted.

EMMA conditions
Legally binding conditions for the transfer

Other EMMA strains

Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).