C57BL/6N-Mir182tm1Wtsi/WtsiH
Status | Available to order |
EMMA ID | EM:12223 |
International strain name | C57BL/6N-Mir182tm1Wtsi/WtsiH |
Alternative name | miR-182 |
Strain type | Targeted Mutant Strains : Knock-out |
Allele/Transgene symbol | Mir182tm1Wtsi, |
Gene/Transgene symbol | Mir182 |
Information from provider
Provider | Haydn Prosser |
Provider affiliation | Wellcome Trust Sanger Institute |
Genetic information | miR-182 deletion: 6:30165901-30166091 (NCBIm38). Deleted genomic sequence for miR-182: tggaccttgtgttaactgtgggaagagcgccctcctaaaaccaccctaactgcttcttcttcagc ataggcttactggtctggctgctggaggcctcccaccatttttggcaatggtagaactcacacc ggtaaggtaatgggacccggtggttctagacttgccaactatggtgtaagtgctgagctgct |
Phenotypic information | Homozygous:Mild hearing deficit.Heterozygous:No obvious phenotype. |
Breeding history | Chimaeras derived from JM8.A3 ES cells (C57BL/6N) were bred with C57BL/6N mice. The mice will be supplied from the Sanger Institute as frozen sperm. |
References |
|
Homozygous fertile | yes |
Homozygous viable | yes |
Homozygous matings required | no |
Immunocompromised | no |
Information from EMMA
Archiving centre | Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom |
Literature references
- Hearing impairment due to Mir183/96/182 mutations suggests both loss and gain of function effects.;Lewis Morag A, Di Domenico Francesca, Ingham Neil J, Prosser Haydn M, Steel Karen P, ;2020;Disease models & mechanisms;14;; 33318051
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).